Xp
NBA       
Xp
  
KBL       
Xp
  
Mania Community. Your Favorite.
Free-Talk
생물학 관련 질문이 있습니다..
 
1
  732
Updated at 2019-10-21 20:12:37

고3까지 완전 문과였는데 대학와서는 이과에 관심이 생겨 생물학 수업을 청강하고 있습니다.

지금 코돈에 대해서 배우고 있는데, ATG가 시작코돈. TAA TAG TGA가 종결코돈이고, 코돈이 번역의 시작과 끝을 알리는 유전암호? 라는거에 대해서는 알겠는데, 실제 예시를 들면서 설명을 하시는걸 전혀 못따라가겠더라구요..

정확하진 않고 대충 이런식의 예시였습니다.

5- ATG GGG AAA TAA 3-

 

예시에서 가능성이 총 6가지 있다고 하셨습니다.

1. ATG GGG AAA TAA

2. A TGG GGA AAT AA

3. AT GGG GAA ATA A 

제 생각에는 3개씩 끊는 방법에 따라 나눠보면 이렇게 3개밖에 없는데요.. 뭔가 다른게 있나요?

 

그리고 저 앞에 5와 3은 뭔가요? 저빼고 다알고있는거같던데.. 도움 부탁드리겠습니다

13
Comments
1
Updated at 2019-10-21 20:17:29

이건 예시가 정확해야 설명해드리기 편한문제네요
예시 알려주시면 답드릴게요

WR
1
2019-10-21 20:18:08
5'  TCAATGTAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATCCACT  3' 

 

PPT에서 정확한 예시를 찾아왔습니다!!

1
1
Updated at 2019-10-21 20:22:42

5와 3이 뜻하는 바는 유전 코드의 방향을 나타냅니다.

5'에서 3'의 방향으로 읽어주시면 됩니다.

3' AAT 5' 이렇게 읽진 않습니다. 5' TTA 3'으로 읽는게 맞습니다.

 

또한 DNA는 상보적으로 결합합니다.

따라서 주어진 5' ATG GGG AAA TAA 3' 의 짝으로 3' TAC CCC TTT ATT 5'가 있고,

이걸 한번 다시 쓰면 5' TTA TTT CCC TAC 3'으로 읽을 수 있습니다.

질문자께서 하셨던 똑같은 방법으로 가능성을 살펴보면

TTA TTT CCC TAC

T TAT TTC CCT AC

TT ATT TCC CTA C

이렇게 3가지가 추가되는 겁니다. 

WR
1
2019-10-21 20:23:44

5와 3이 방향을 알려주는거였군요.. 상보적이라는 개념을 아예 몰라서 답이 안나왔던 거네요..

A는 T로, C는 G로 바꾸는거군요! 감사합니다!!

1
2019-10-21 20:28:56

실례가 되지 않는다면 조언(이라 쓰고 오지랖이라 읽습니다)하나만 하겠습니다..

고등학교 생물을 배우지 않으셔서 배경지식이 없어 생긴 질문같습니다.

시간의 여유가 있으시다면 EBS같은 사이트에서

생명과학 2 유전물질 ~ 유전자의 발현 부분 인강을 들으신다면 도움이 될 것 같습니다.

WR
1
2019-10-21 20:34:04

EBS 생각을 전혀 못했네요!! 바로 들어보겠습니다. 감사합니다!

1
2019-10-21 20:18:15

뉴클레오타이드에 당을 이루는 부분은 탄소가 5개 있는데요, 이때 번호를 각각 붙여서 1' 2' ...5'입니다.
이때 5'과 인산기 부분이 연결되있고 3'이 다음 뉴클레오타이드의 인산기와 결합하여 DNA뼈대를 이룹니다. DNA가 풀려서 각각 복제나 전사될때 방향이 5'부터 3'방향으로 새로운 가닥을 만들어나갑니다. 이상의 내용은 고등학교 생2에도 있습니당

1
2019-10-21 20:19:07

반대쪽 대응하는 서열이 있기때문에 6개로 보이네요
5랑 3은 염기가 붙어있는 줄기가 5탄당 아데노신인가 그럴겁니다. 그래서 5개 탄소 고리의 5번탄소랑 다른 아데노신의 3번탄소가 연결되어 strand가 되어 방향을 표시하기위해 5번탄소 방향 3번 탄소 방향을 표시한겁니다.

1
2019-10-21 20:20:21

아 아데노신은 염기 A죠 참.. 줄기 구조가 뭐였는지는 정확히 기억이 안나네요

1
2019-10-21 22:04:21

Phosphate랑 (deoxy)rebose가 backbone 이었던거 같네요..

1
2019-10-21 20:19:39

5와 3은 간단하게 DNA - 디옥시리보오스의 몇번째 탄소인지를 의미하는데,

 | https://m.terms.naver.com/…

이걸 보시면 이해하기 어렵지 않을것 같습니다!

WR
1
2019-10-21 20:36:00

다들 답변 감사합니다!! EBS 생물을 들어봐야 배경지식이 생겨서 제대로 수업을 들을수 있을 것 같습니다!

1
Updated at 2019-10-21 22:36:36

대단하시네요. 제 친구 중에도 문과친구가 고3때 생물학을 하겠다고해서 재수해서 화공을 간 경우가 있었네요.(응?) 취미이든, 진지하게 임하시는거든 건승하시길 바랍니다~

19-11-15
1
236
1
글쓰기
검색 대상
띄어쓰기 시 조건